circad | circRNAs associated with diseases

hsa_circ_0001946
Gene	CDR1	Organism	Human
Genome Locus	chrX:139865339-139866824:+	Build	hg19
Disease	Lung Adenocarcinoma	ICD-10	Malignant neoplasm of bronchus and lung (C34)
DBLink	Link to database	PMID	30841451
Experimental Method
Sample Type	Tissue and cell lines	Comparison	72 Fresh cancerous tissuesof primary LAC and normal paracancerous tissues
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward CGGGTCTTCCAGGAAATCCG Reverse TCCGG AAGATGTGGATTGACTG	Statistics	Fold Change : Upregulated pvalue : p<0.05
Citation
Yao, Y, Hua, Q, Zhou, Y, Shen, H (2019). CircRNA has_circ_0001946 promotes cell growth in lung adenocarcinoma by regulating miR-135a-5p/SIRT1 axis and activating Wnt/β-catenin signaling pathway. Biomed. Pharmacother., 111:1367-1375.